Biopython

Biopython is a set of freely available tools for biological computation written in Python. It provides a standard way to work with biological data formats, sequences, and online databases, making it easier for scientists and developers to write Python scripts for bioinformatics analysis. \n\nIts primary goal is to provide a complete and consistent interface to common bioinformatics file formats, databases, and algorithms, abstracting away the complexities of parsing and interacting with various biological data sources. \n\nKey features and modules of Biopython include:\n\n- Sequence Objects (`Bio.Seq`): Provides powerful objects for representing biological sequences (DNA, RNA, protein) with methods for common manipulations like transcription, translation, and reverse complementation.\n- Sequence Record Objects (`Bio.SeqRecord`): Extends `Seq` objects to include metadata such as ID, name, description, features, and annotations, typically used when parsing biological files.\n- Input/Output (`Bio.SeqIO`): A universal parser and writer for a wide array of biological file formats, including FASTA, GenBank, EMBL, PDB, Newick, and more, simplifying file handling.\n- Access to NCBI Databases (`Bio.Entrez`): Offers a programmatic interface to interact with NCBI's Entrez system, allowing retrieval of data from databases like PubMed, GenBank, Nucleotide, Protein, etc.\n- Sequence Alignment (`Bio.Align`): Tools for performing and analyzing sequence alignments, including interfaces to external alignment programs like Clustal W/O and BLAST.\n- Phylogenetics (`Bio.Phylo`): Functionality for working with phylogenetic trees, including parsing common tree formats (Newick, Nexus, PhyloXML) and performing tree manipulations.\n- Structural Biology (`Bio.PDB`): A module for working with protein structures from PDB files, enabling analysis of atoms, residues, chains, and models.\n- Interfaces to External Tools: Provides wrappers for popular command-line bioinformatics tools like BLAST, ClustalW, and EMBOSS, allowing them to be run and their output parsed within Python scripts.\n\nBiopython simplifies many complex bioinformatics tasks, reduces development time, and leverages the power and readability of the Python programming language, making it an indispensable tool for computational biologists.

from Bio.Seq import Seq\nfrom Bio.SeqRecord import SeqRecord\nfrom Bio import SeqIO\nfrom Bio import Entrez\nfrom io import StringIO\n\n --- 1. Working with Seq objects ---\nprint("--- Sequence Object Manipulation ---")\ndna_seq = Seq("ATGCAGTGACGTACGTAGCTAGCTAGC")\nprint(f"Original DNA: {dna_seq}")\nprint(f"Complement: {dna_seq.complement()}")\nprint(f"Reverse Complement: {dna_seq.reverse_complement()}")\n\nrna_seq = dna_seq.transcribe()\nprint(f"RNA: {rna_seq}")\n\nprotein_seq = rna_seq.translate()\nprint(f"Protein (translated from RNA): {protein_seq}\n")\n\n --- 2. Reading a FASTA file using SeqIO (simulated with StringIO) ---\nprint("--- Reading FASTA with SeqIO ---")\nfasta_content = """>seq1 Description for sequence 1 (E. coli)\nATGCGTACGTACGTAGCTAGCTAGCGCGATGCATGC\n>seq2 Description for sequence 2 (Human)\nGCTAGCTAGCTAGCTAGCTACGTAGATCGATCGATC\n"""\n\n Use StringIO to treat the string as a file\nfasta_file_handle = StringIO(fasta_content)\n\nfor record in SeqIO.parse(fasta_file_handle, "fasta"):\n    print(f"ID: {record.id}")\n    print(f"Name: {record.name}")\n    print(f"Description: {record.description}")\n    print(f"Sequence (first 20 chars): {record.seq[:20]}...")\n    print(f"Length: {len(record.seq)}\n")\n\n --- 3. Accessing NCBI databases using Bio.Entrez ---\nprint("--- Entrez Fetch Example (HIV-1 genome) ---")\nEntrez.email = "your.email@example.com"   Always tell NCBI who you are\n\ntry:\n     Fetch a GenBank record by ID\n    handle_gb = Entrez.efetch(db="nucleotide", id="AY856001", rettype="gb", retmode="text")\n    record_gb_text = handle_gb.read()\n    print(f"First 500 chars of GenBank record AY856001:\n{record_gb_text[:500]}...\n")\n    handle_gb.close()\n\n     Fetch and parse a FASTA record by ID\n    handle_fasta = Entrez.efetch(db="nucleotide", id="AY856001", rettype="fasta", retmode="text")\n    record_fasta = SeqIO.read(handle_fasta, "fasta")\n    print(f"Fetched FASTA ID: {record_fasta.id}")\n    print(f"Fetched FASTA Sequence length: {len(record_fasta.seq)}\n")\n    handle_fasta.close()\n\nexcept Exception as e:\n    print(f"Error fetching data from Entrez: {e}")\n    print("This might be due to network issues, NCBI rate limits, or an invalid email. Please ensure 'your.email@example.com' is replaced with a valid email.")\n